ID: 969473823_969473825

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 969473823 969473825
Species Human (GRCh38) Human (GRCh38)
Location 4:7409399-7409421 4:7409427-7409449
Sequence CCAACAGCATGGTGCTGCTGAAC CTCTGATTTGGAGTCCCCTTTGG
Strand - +
Off-target summary {0: 8, 1: 25, 2: 54, 3: 68, 4: 213} {0: 1, 1: 0, 2: 13, 3: 68, 4: 212}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!