ID: 969482773_969482779

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 969482773 969482779
Species Human (GRCh38) Human (GRCh38)
Location 4:7455521-7455543 4:7455546-7455568
Sequence CCTCCGTGTTAGTGTCATGCGCC GTTAGGGTCAGGCACTGTGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 23} {0: 2, 1: 23, 2: 17, 3: 52, 4: 205}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!