ID: 969482981_969482997

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 969482981 969482997
Species Human (GRCh38) Human (GRCh38)
Location 4:7456740-7456762 4:7456768-7456790
Sequence CCTTGGGTGCCTGCTGCTTGTCC TGGCAGGGGTAGGGGGGTGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 273} {0: 1, 1: 3, 2: 61, 3: 353, 4: 2497}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!