ID: 969484176_969484188

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 969484176 969484188
Species Human (GRCh38) Human (GRCh38)
Location 4:7462640-7462662 4:7462685-7462707
Sequence CCAGGGATGGAGCCTCTTGTTCA CTCTGGGTCTGGCACGCAGGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 26, 4: 159} {0: 1, 1: 0, 2: 1, 3: 26, 4: 362}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!