ID: 969517629_969517635

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 969517629 969517635
Species Human (GRCh38) Human (GRCh38)
Location 4:7656449-7656471 4:7656470-7656492
Sequence CCATGCGGGTCTCCCTCATGTCA CACAGGGAAGAACTGAGGCTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 91} {0: 1, 1: 0, 2: 5, 3: 60, 4: 548}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!