ID: 969537326_969537330

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 969537326 969537330
Species Human (GRCh38) Human (GRCh38)
Location 4:7764654-7764676 4:7764690-7764712
Sequence CCCTGAGTGCTGGCTGCAGATGG AGTGCCAGCACTGTGAAAGCAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 11, 3: 60, 4: 295} {0: 1, 1: 0, 2: 3, 3: 28, 4: 287}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!