ID: 969537328_969537333

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 969537328 969537333
Species Human (GRCh38) Human (GRCh38)
Location 4:7764655-7764677 4:7764698-7764720
Sequence CCTGAGTGCTGGCTGCAGATGGC CACTGTGAAAGCAGGGACAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 266} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!