ID: 969545079_969545085

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 969545079 969545085
Species Human (GRCh38) Human (GRCh38)
Location 4:7820726-7820748 4:7820746-7820768
Sequence CCATTTTAATGAAAGGCAGAGTG GTGAGGATGTGGAGGGAAGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 15, 3: 123, 4: 1450}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!