ID: 969564087_969564089

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 969564087 969564089
Species Human (GRCh38) Human (GRCh38)
Location 4:7967453-7967475 4:7967489-7967511
Sequence CCTTCAGTGGTCATATTTGTTAC CACAGCTGCCATCCGAGAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 129} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!