ID: 969568122_969568129

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 969568122 969568129
Species Human (GRCh38) Human (GRCh38)
Location 4:7992209-7992231 4:7992242-7992264
Sequence CCTGGGGCACAGGGCCTGGCCCC AATCAGCCCCCAGATTGTCTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 6, 3: 87, 4: 739} {0: 1, 1: 0, 2: 0, 3: 8, 4: 158}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!