ID: 969569389_969569403

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 969569389 969569403
Species Human (GRCh38) Human (GRCh38)
Location 4:7999812-7999834 4:7999857-7999879
Sequence CCGCCTCCCCTCCATGAAGCCTG ACCCCGCCAGGCCTGCTCTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 58, 4: 493} {0: 1, 1: 0, 2: 2, 3: 20, 4: 204}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!