ID: 969586702_969586704

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 969586702 969586704
Species Human (GRCh38) Human (GRCh38)
Location 4:8098016-8098038 4:8098031-8098053
Sequence CCCTCAGGACAACTTGCTGGTCA GCTGGTCACCACCAGCTCAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 124} {0: 1, 1: 0, 2: 1, 3: 51, 4: 220}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!