ID: 969597437_969597442

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 969597437 969597442
Species Human (GRCh38) Human (GRCh38)
Location 4:8157396-8157418 4:8157422-8157444
Sequence CCACTCCCAGATAACTAGGTTGG TTTCAGAAATCCTCTTCCAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 82} {0: 1, 1: 0, 2: 0, 3: 28, 4: 372}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!