ID: 969607270_969607275

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 969607270 969607275
Species Human (GRCh38) Human (GRCh38)
Location 4:8208749-8208771 4:8208768-8208790
Sequence CCGGGCGAGTGCACGCCACTGCA TGCAGGTGGTCAGCAAATGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 66, 4: 179} {0: 1, 1: 0, 2: 4, 3: 44, 4: 246}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!