ID: 969625367_969625370

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 969625367 969625370
Species Human (GRCh38) Human (GRCh38)
Location 4:8302234-8302256 4:8302268-8302290
Sequence CCACCTGTGGGGCGAGCCACACT ACCCCTCAGCTCCATGATGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 80} {0: 1, 1: 0, 2: 0, 3: 15, 4: 151}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!