ID: 969626028_969626036

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 969626028 969626036
Species Human (GRCh38) Human (GRCh38)
Location 4:8306247-8306269 4:8306268-8306290
Sequence CCTCCTGGCTGTCCGGGGCAGAG AGCGGAGGCTGGGCTTGGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 254} {0: 1, 1: 0, 2: 0, 3: 53, 4: 444}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!