ID: 969645654_969645661

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 969645654 969645661
Species Human (GRCh38) Human (GRCh38)
Location 4:8427399-8427421 4:8427447-8427469
Sequence CCATCCACCACTGCTGATGGCTG CACCCCCCTCCAGATCCAGCAGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 50, 3: 140, 4: 350} {0: 1, 1: 0, 2: 4, 3: 39, 4: 286}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!