ID: 969648372_969648375

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 969648372 969648375
Species Human (GRCh38) Human (GRCh38)
Location 4:8447587-8447609 4:8447607-8447629
Sequence CCTTGAAATGGGTTTAATCATTC TTCCTGAGCCTCTGAGGAGGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 31, 4: 425} {0: 1, 1: 0, 2: 5, 3: 62, 4: 1161}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!