ID: 969756451_969756462

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 969756451 969756462
Species Human (GRCh38) Human (GRCh38)
Location 4:9153256-9153278 4:9153297-9153319
Sequence CCTCCAGGTCTCCAGGCAACGCT TGGCGCCCGAGGAGAACGCGGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!