ID: 969793365_969793373

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 969793365 969793373
Species Human (GRCh38) Human (GRCh38)
Location 4:9507468-9507490 4:9507488-9507510
Sequence CCACCCCCAGTTGGGCCCACATG ATGAAAGAGAGGATATGCAAAGG
Strand - +
Off-target summary No data {0: 42, 1: 22, 2: 15, 3: 41, 4: 461}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!