ID: 969992121_969992125

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 969992121 969992125
Species Human (GRCh38) Human (GRCh38)
Location 4:11275449-11275471 4:11275493-11275515
Sequence CCCAGGATAAATTTTCTGCACCC GCTCACTGCTTTTTAGCTAGAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!