ID: 970008074_970008082

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 970008074 970008082
Species Human (GRCh38) Human (GRCh38)
Location 4:11429041-11429063 4:11429065-11429087
Sequence CCGGCCCGCTCGGGTGCCGCCCA AGTCCGGCCCGCTAGGTGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 102} {0: 1, 1: 0, 2: 0, 3: 2, 4: 29}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!