ID: 970192170_970192178

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 970192170 970192178
Species Human (GRCh38) Human (GRCh38)
Location 4:13527677-13527699 4:13527692-13527714
Sequence CCTGCGCGGTGGGACCCGCGCGG CCGCGCGGGGGCAGTGGCGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 98} {0: 1, 1: 0, 2: 1, 3: 30, 4: 351}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!