ID: 970333319_970333332

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 970333319 970333332
Species Human (GRCh38) Human (GRCh38)
Location 4:15004756-15004778 4:15004778-15004800
Sequence CCCGGACCCCCGACGCGGGGAGG GCGCGGCGAGGACCGGGGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 128} {0: 1, 1: 0, 2: 4, 3: 36, 4: 490}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!