ID: 970389373_970389381

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 970389373 970389381
Species Human (GRCh38) Human (GRCh38)
Location 4:15592165-15592187 4:15592217-15592239
Sequence CCATGCTCCACTATTCCATCCAA TCTATCTATTGATACGCTCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 166} {0: 1, 1: 0, 2: 0, 3: 4, 4: 52}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!