ID: 970398908_970398916

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 970398908 970398916
Species Human (GRCh38) Human (GRCh38)
Location 4:15699536-15699558 4:15699573-15699595
Sequence CCTGAAACTGGGAACAGAAAGAG ACAGTTCTGCATGGCTGGGGAGG
Strand - +
Off-target summary No data {0: 795, 1: 2561, 2: 7056, 3: 8516, 4: 6784}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!