ID: 970399730_970399737

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 970399730 970399737
Species Human (GRCh38) Human (GRCh38)
Location 4:15705631-15705653 4:15705684-15705706
Sequence CCAGAGATAAGGTAACACCACAA CTACAGAAATGGATGGTGCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 118} {0: 1, 1: 1, 2: 1, 3: 19, 4: 174}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!