ID: 970608450_970608456

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 970608450 970608456
Species Human (GRCh38) Human (GRCh38)
Location 4:17704100-17704122 4:17704138-17704160
Sequence CCACACAACAGTGCATGCCCCAG TTTCAGTGGACACTCAAAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 208} {0: 1, 1: 0, 2: 0, 3: 11, 4: 115}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!