ID: 970644954_970644957

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 970644954 970644957
Species Human (GRCh38) Human (GRCh38)
Location 4:18109047-18109069 4:18109079-18109101
Sequence CCTGCTTCTGGCAAATTGGGCTC GCCATAGGCAGATCAGCCTTGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!