ID: 970764357_970764358

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 970764357 970764358
Species Human (GRCh38) Human (GRCh38)
Location 4:19529565-19529587 4:19529582-19529604
Sequence CCATAAAAAATAATAAAATCCTG ATCCTGTTATTTGTGCAACATGG
Strand - +
Off-target summary {0: 7, 1: 111, 2: 813, 3: 3240, 4: 8653} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!