|
Left Crispr |
Right Crispr |
Crispr ID |
970764357 |
970764358 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
4:19529565-19529587
|
4:19529582-19529604
|
Sequence |
CCATAAAAAATAATAAAATCCTG |
ATCCTGTTATTTGTGCAACATGG |
Strand |
- |
+ |
Off-target summary |
{0: 7, 1: 111, 2: 813, 3: 3240, 4: 8653} |
No data |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|