ID: 970852535_970852539

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 970852535 970852539
Species Human (GRCh38) Human (GRCh38)
Location 4:20618170-20618192 4:20618190-20618212
Sequence CCTTCCTCCTTCTCCTTTGTCTG CTGCGTGATCAGAGCTCGCCTGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 9, 3: 161, 4: 1403} {0: 1, 1: 0, 2: 1, 3: 5, 4: 61}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!