ID: 970852535_970852540

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 970852535 970852540
Species Human (GRCh38) Human (GRCh38)
Location 4:20618170-20618192 4:20618201-20618223
Sequence CCTTCCTCCTTCTCCTTTGTCTG GAGCTCGCCTGGCCTCCAGCTGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 9, 3: 161, 4: 1403} {0: 1, 1: 0, 2: 2, 3: 17, 4: 193}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!