ID: 970882407_970882412

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 970882407 970882412
Species Human (GRCh38) Human (GRCh38)
Location 4:20947398-20947420 4:20947416-20947438
Sequence CCCTCATGTGGTCCACCTGCCTC GCCTCGGCCTCCCAAAGTGCTGG
Strand - +
Off-target summary No data {0: 81513, 1: 207817, 2: 222817, 3: 151393, 4: 177060}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!