|
Left Crispr |
Right Crispr |
Crispr ID |
970882407 |
970882412 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
4:20947398-20947420
|
4:20947416-20947438
|
Sequence |
CCCTCATGTGGTCCACCTGCCTC |
GCCTCGGCCTCCCAAAGTGCTGG |
Strand |
- |
+ |
Off-target summary |
No data |
{0: 81513, 1: 207817, 2: 222817, 3: 151393, 4: 177060} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|