ID: 970922985_970922988

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 970922985 970922988
Species Human (GRCh38) Human (GRCh38)
Location 4:21416785-21416807 4:21416831-21416853
Sequence CCTATCATGGGACTATATGTCAG GGGAAGAATTCCACTTGTTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 78} {0: 1, 1: 0, 2: 1, 3: 11, 4: 143}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!