ID: 970926872_970926877

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 970926872 970926877
Species Human (GRCh38) Human (GRCh38)
Location 4:21462202-21462224 4:21462232-21462254
Sequence CCCATGTATTTGTGTGTTTTCAC ATAAAGATATACCCAAGACTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 25, 3: 222, 4: 1014} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!