ID: 971279903_971279916

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 971279903 971279916
Species Human (GRCh38) Human (GRCh38)
Location 4:25234289-25234311 4:25234328-25234350
Sequence CCCAGGCAGCGCCGTGAGGCTGC GGAGGGCGAGGCCGGCGACGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 154} {0: 1, 1: 0, 2: 3, 3: 33, 4: 425}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!