ID: 971355511_971355513

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 971355511 971355513
Species Human (GRCh38) Human (GRCh38)
Location 4:25891312-25891334 4:25891329-25891351
Sequence CCAAACTCCGAAGCTTGGGTCTT GGTCTTAATCCCCCGAGACCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 103} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!