ID: 972251586_972251592

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 972251586 972251592
Species Human (GRCh38) Human (GRCh38)
Location 4:37308535-37308557 4:37308554-37308576
Sequence CCAGGTAAACCAGACCTTGGGTC GGTCCCTGGGGAGCATGCACAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 5, 3: 21, 4: 225}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!