ID: 972312498_972312502

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 972312498 972312502
Species Human (GRCh38) Human (GRCh38)
Location 4:37893793-37893815 4:37893824-37893846
Sequence CCATTCAGCAGCAGAGTAGTGTT TATCCCTGTAGTGATGACGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 29, 4: 86}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!