ID: 972520944_972520946

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 972520944 972520946
Species Human (GRCh38) Human (GRCh38)
Location 4:39856015-39856037 4:39856047-39856069
Sequence CCACACTGAGACACATCAGGGTC AACATTTGATAAAGAGATAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 221} {0: 1, 1: 2, 2: 12, 3: 65, 4: 576}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!