ID: 972543197_972543205

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 972543197 972543205
Species Human (GRCh38) Human (GRCh38)
Location 4:40056885-40056907 4:40056920-40056942
Sequence CCCGCGGCCGCAGCTGCTTGCTA GCGGGAGAGCGCAGTGGCGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 125} {0: 1, 1: 0, 2: 1, 3: 15, 4: 206}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!