ID: 972552192_972552202

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 972552192 972552202
Species Human (GRCh38) Human (GRCh38)
Location 4:40144182-40144204 4:40144222-40144244
Sequence CCCACATGGTTGGTGCCTGCCCG CTTTCTGTCCACTGACATGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 92} {0: 1, 1: 0, 2: 4, 3: 22, 4: 180}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!