ID: 972597488_972597497

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 972597488 972597497
Species Human (GRCh38) Human (GRCh38)
Location 4:40542744-40542766 4:40542793-40542815
Sequence CCAGGTTGGTCTTGAACTCCTGA TCCCTATGTGCTGGGATTGCAGG
Strand - +
Off-target summary {0: 1723, 1: 56932, 2: 142215, 3: 225544, 4: 174716} {0: 2, 1: 82, 2: 8827, 3: 308303, 4: 273243}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!