ID: 972624106_972624109

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 972624106 972624109
Species Human (GRCh38) Human (GRCh38)
Location 4:40779314-40779336 4:40779341-40779363
Sequence CCTGTCTCTGCCAGGCACTGTGG CGCTTGTAATCCCAGCACTTTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 22, 3: 169, 4: 960} {0: 4214, 1: 133667, 2: 277190, 3: 221574, 4: 152657}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!