ID: 972629318_972629328

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 972629318 972629328
Species Human (GRCh38) Human (GRCh38)
Location 4:40829641-40829663 4:40829673-40829695
Sequence CCTGAAAAGCAAGAGACTCCATC CCATGGGTGTGTAGGGCAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 151} {0: 1, 1: 0, 2: 1, 3: 29, 4: 277}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!