ID: 972632775_972632780

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 972632775 972632780
Species Human (GRCh38) Human (GRCh38)
Location 4:40856775-40856797 4:40856792-40856814
Sequence CCCCCCATTTCATACAAGCCTCA GCCTCACTCCTTCTTCCCACCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 41, 4: 293}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!