ID: 972637094_972637099

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 972637094 972637099
Species Human (GRCh38) Human (GRCh38)
Location 4:40893967-40893989 4:40893996-40894018
Sequence CCATCTCAACAACAACAACAAAA TAGATTATGAGGGCCGGGCGCGG
Strand - +
Off-target summary {0: 248, 1: 801, 2: 2071, 3: 4027, 4: 116398} {0: 1, 1: 0, 2: 10, 3: 83, 4: 693}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!