ID: 972645178_972645181

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 972645178 972645181
Species Human (GRCh38) Human (GRCh38)
Location 4:40961105-40961127 4:40961128-40961150
Sequence CCATCATATTAGTGGACTGCTAC TGCCAGGCTTCTATGTGAAAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 8, 4: 171}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!