ID: 972659976_972659982

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 972659976 972659982
Species Human (GRCh38) Human (GRCh38)
Location 4:41106804-41106826 4:41106843-41106865
Sequence CCAAGTACCTAGATCTTGGTTTC CTGGAGAAATAGTTGGGTCTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 20, 4: 327}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!