ID: 972698283_972698289

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 972698283 972698289
Species Human (GRCh38) Human (GRCh38)
Location 4:41469079-41469101 4:41469114-41469136
Sequence CCAAGAGTCATCTGTGCATCCAC TGATAATTCCTTTTATGAGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 151} {0: 1, 1: 0, 2: 1, 3: 14, 4: 242}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!